Re-Examining the Out-of-Africa Theory and the Origin of Europeoids (Caucasoids). Part 2. SNPs, Haplo

Advances in Anthropology

2012. Vol.2, No.4, 198-213

Published Online November 2012 in SciRes (http://www.SciRP.org/journal/aa) http://dx.doi.org/10.4236/aa.2012.24022

198

Re-Examining the Out-of-Africa Theory and the

Origin of Europeoids (Caucasoids).

Part 2. SNPs, Haplogroups and Haplotypes

in the Y-Chromosome of Chimpanzee and Humans

Anatole A. Klyosov, Igor L. Rozhanskii, Lyudmila E. Ryabchenko

The Academy of DNA Genealogy, Newton, USA

Email: aklyosov@comcast.net

Received July 12th, 2012; revised August 22nd, 2012; accepted September 12th, 2012

Our consideration of human haplogroups, and our analysis of the dynamics of the Y-chromosome nucleo-

tide flow from primates to humans during the evolution of genus Homo has shown that a common ances-

tor of the majority of present day human males, both African and non-African, lived approximately

160,000 years ago. The haplogroup of this common ancestor has been identified as the α-haplogroup,

which is equivalent or close to haplogroups A1/A1b in the current phylogeny. The archaic lineages (cur-

rently summarily designated A0) descend from an ancestor who lived no later than 180,000 years ago,

and probably much earlier. The α-haplogroup and the A0 lineages have significantly different nucleotide

patterns, and they certainly did not descend one from another. Furthermore, our research points up the ar-

eas of mutations in Y-chromosome in H. sapiens, which allows us to use chimpanzee MSY (the male-

specific region of the Y-chromosome) as a proxy for genus Homo’s common α-haplogroup ancestor.

When we studied slow mutating 16-marker haplotypes, we discovered that chimpanzees and present day

humans had a common ancestor 5.5 ± 0.9 million years before the present. It is clear that, when they are

compared to loci in other primates, such as gorillas, orangutans, and macaques, many human

Y-chromosome loci have been conserved from our common ancestor. Results of our analysis of haplo-

types, conserved (ancestral) nucleotides, and SNPs suggest that there is no reason to believe that ancestors

of non-Africans (β-haplogroup, i.e. haplogroup BT and its downstream haplogroups) descended from

haplogroups A0, A1a, or any other African haplogroup. The data are adequately described by a model

which shows that the African lineages and non-African lineages diverged from the α-haplogroup ap-

proximately 160,000 years before the present and that the Y-chromosomes of the two groups have

evolved independently (in terms of Y-chromosome) since then. We have no indication of where the

common ancestor of the α-haplogroup lived; he could just as easily have lived in Europe, in Asia, or in

the Middle East, as in (less likely) Africa. We believe that all the presuppositions posited in support of the

Out-of-Africa hypothesis fail to hold up under simple scrutiny. This study shows that the Out-of-Africa

hypothesis has not been adequately substantiated. The common assertion that “anatomically modern hu-

mans came out of Africa some 70,000 years ago” has never been convincingly calculated or determined

otherwise; our research suggests that it is incorrect.

Keywords: Y-Chromosome; Mutations; Haplotypes; Haplogroups; Primates; Chimpanzees, SNP;

Out-of-Africa

Introduction

In the first part of our two-part study (Re-examining the “Out

of Africa” theory and the origin of Europeoids (Caucasoids) in

light of DNA genealogy [Klyosov & Rozhanskii, 2012a]) we

considered the origin of anatomically modern humans (AMH),

who presumably belong to Y-chromosomal haplogroups A

through T according to the classification developed in human

genetics and in the DNA phylogeny of man. Our first article

also set forth a time frame for the origin of haplogroups A and

B—the first (partly) African and the second the origin of seem-

ingly non-African, which later migrated to Africa.

In our earlier paper we identified the relative position of the

haplogroups known today, and suggested a re-examination the

validity of the Out-of-Africa hypothesis. Looking at slow

changing 22-marker haplotypes, we discovered that African

haplogroup A originated 132,000 ± 12,000 years before the

present, and is remote from all other haplogroups, which origin-

nated (or, rather, came through a population bottleneck) about

64,000 ± 6000 ybp. These other haplogroups—BT (names BT

and BR are both used in the nomenclature and are considered

practically equivalent in general context) and those downstream

from it--include the Europeoid (Caucasoid) haplogroups from F

through T that originated 58,000 ± 5000 ybp. About 160,000 ±

12,000 ybp haplogroups A1, A1a, A1b (in the current classify-

cation) and BT had a common ancestor in the α-haplogroup.

We showed that BT did not descend from haplogroup A; but

rather that the lineages were two sides of a bifurcation in the α-

haplogroup. The two lineages evolved distinctly with respect to

the Y-chromosome.

A. A. KLYOSOV ET AL.

The Essence of the Out-of-Africa Hypothesis

The Out-of-Africa hypothesis arose in the middle of the

1980s, under heavy influence of DNA-related interpretations.

One of the first articles (Stringer & Andrews, 1988), which

initiated the idea, stated that “Genetic data on present human

population relationships and data from the Pleistocene fossil

hominid record are used to compare two contrasting models for

the origin of modern humans”. We now know that early genetic

data were inaccurate and that the hominid fossil record was

(and still is) controversial. In the same year, by studying 42

world populations Cavalli-Sforza et al. (1988) found that the

phylogenetic tree separates Africans from non-Africans. They

took this as an indication that “the origin of modern humans

was in Africa”, even though the opposite, that is “the origin of

modern humans was not in Africa” would have been equally

valid. Later, the Out-of-Africa hypothesis acquired five essen-

tial presuppositions:

1) All haplogroups, from B to T, descended from haplogroup

2) The first anatomically modern human (AMH) came Out-

of-Africa around 70,000 years ago.

3) Africa has the highest genetic diversity. Therefore, the

AMH descended from African populations.

4) Genetic diversity decreases as the distance from Africa

increases. Therefore, Africa is the homeland of mankind.

5) The earliest AMH was found in Africa. He presumably is

the direct ancestor of all the human beings living today.

We concluded in the first article of this set (Klyosov & Roz-

hanskii, 2012a) that the Out-of-Africa hypothesis needed

re-examination. The mutations in the Y-chromosome haplo-

types of Africans and non-Africans clearly indicate that

1) non-Africans could not have descend from Africans;

2) haplogroup B which is about 120,000 years remote from

haplogroup A, is not-initially-an African haplogroup;

3) African haplogroup A and all non-African haplogroups

(BT) diverged from a common α-haplogroup ancestor who

lived 160,000 ± 12,000 ybp.

There is no indication that non-African haplogroups resided

in Africa. Furthermore, it was recently recognized that there is

no such thing as a single haplogroup A. Instead, haplogroup A

is an umbrella for a variety of haplogroups, some of which

originated more than 160,000 ybp.

The Five Presuppositions of the

Out-of-Africa Hypothesis

Let us briefly consider the five presuppositions listed above,

which are the underpinnings of the Out-of-Africa hypothesis.

Presupposition 1 was maintained for many years by the In-

ternational Society of Genetic Genealogy (ISOGG) with the

following description: “The BR haplogroup split off from hap-

logroup A 55,000 years before present (bp). It probably ap-

peared in North East Africa” Similarly, the introduction to the

FTDNA haplogroup A Project (see “Materials and Methods”)

begins “Haplogroup A is unique in that all other human hap-

logroups spring from its primal branches”. Another similar

quotation—“Haplogroup A, first appearing 55,000 years ago,

is the oldest of all Y haplogroups and is considered a direct ge-

netic link to early man” (Chromosomal Laboratories, 2005).

Since we know that the common ancestor of haplogroup A and

all other haplogroups belonged initially to the α-haplogroup

(which arose 160,000 ybp), and haplogroup B is remote from

haplogroup A by at least 120,000 years, it is clear that hap-

logroup BT (which arose 64,000 ybp) could not possibly have

“split off from haplogroup A 55,000 ybp”. This chronological

construction provides inadequate support to the Out-of-Africa

hypothesis.

Even if some researchers did not consider haplogroup

A-M91 to be ancestral to the BR haplogroup (e.g. Cruciani et

al., 2002), the literature abounds in interpretations which create

an impression that African haplogroups were ancestral to

non-African haplogroups. For example, Chiaroni, Underhill and

Cavalli-Sforza (2009) state: “haplogroups A and B are the

deepest branches in the phylogeny and are essentially restricted

to Africa, bolstering the evidence that modern humans first

arose there”. Actually, haplogroup B is not among the deepest

branches, (cf. Figure 1). Second, Chiaroni, et al., do not indi-

cate from which particular haplogroup “modern humans first

arose [in Africa]”. From haplogroup A? No, haplogroup A (see

Figure 1) is distinct from BT, as Cruciani, et al., pointed out in

2002. From haplogroup B? No, BT was initially one hap-

logroup and haplogroup B split from it. From some chromoso-

mal Adam 160,000 years ago evolving directly into non-Afri-

cans? This cannot be serious. It seems that such Out-of-Africa

statements have not been thought through in terms of Y-chro-

mosome phylogeny.

It is interesting to note that SNP M91 long considered an Af-

rican SNP, has recently been re-assigned by ISOGG to

non-African haplogroups (ISOGG-2012) (cf. Cruciani et al.,

2002; ISOGG, 2006-2011). This move may have been an at-

tempt to keep the nomenclature in line with the Out-of-Africa

hypothesis. However, the respective nucleotide sequences in

chimpanzee MSY and the BT haplogroup are identical (9T),

while the African subclade A1a has 8T; therefore, M91 should

belong to the African lineages. On the other hand, M91 is 8T in

A1b, which is a part of the α-haplogroup. This means, that after

its transition from the α-haplogroup to the β-haplogroup (BT)

8T9T, the sequence returned to its ancestral state, and the

SNP in BT should be designated differently than M91. All of

these data indicate that BT haplogroups did not descend from

the “African haplogroup A”; additionally, the slow 22-marker

haplotypes quite convincingly show this (Klyosov & Roz-

hanskii, 2012a). More genome-based data will be provided

below in this paper.

Presupposition 2 became a cliché in almost every article in

which the Out-of-Africa hypothesis has been mentioned. A few

examples, specifying when AMH allegedly came Out-of-Africa,

are:

 “50 thousand years ago” (Jobling & Tyler-Smith, 2003)

 “50 - 60 thousand years ago” (Shi et al., 2010; Mellars,

2011)

 “50 - 70 thousand years ago” (Hydjasov et al., 2007;

Stoneking & Delfin, 2010)

 “60 thousand years ago” (Li & Durbin, 2011; Henn et al.,

2011)

 “60 - 70 thousand years” (Ottoni et al., 2010)

 “60 thousand years ago” (Stewart & Stringer, 2012)

 “45 - 50 thousand years ago” (Fernandes et al., 2012)

 “50 - 65 thousand years before present” (Behar et al., 2008)

 “60 thousand years ago” (Chiaroni et al., 2009)

 “50 - 75 thousand years ago” (Patin et al., 2009)

 “50 thousand years ago” (Edmonds et al., 2004)

 “45 thousand years ago” (Moorjani et al., 2011)

 “50 - 70 thousand years ago” (Xue et al., 2005)



“70 - 80 thousand years ago” (Majumder, 2010)

A. A. KLYOSOV ET AL.

200

Figure 1.

Haplogroup tree of the H. sapiens Y-chromosome derived from haplotypes and subclades. This diagram

shows the most recent common ancestors (TMRCAs) of H. sapiens as described in this study. To prepare this

tree, we analyzed 7415 haplotypes from 46 subclades of 17 major haplogroups. The timescale on the vertical

axis shows thousands of years from the common ancestors of the haplogroups and subclades. The tree shows

the α-haplogroup, which is ancestral to both the African and non-African haplogroups, and the β-haplogroup,

which is equivalent to haplogroup BT in the current classification. The left branch haplogroup A arose

~132,000 ybp. Haplogroups F through R (which includes T) represent Europeoids (Caucasoids) who arose

~58,000 years before the present. The Mongoloid and Austronesian haplogroup C split ~36,000 ybp; the Mid-

dle Eastern haplogroups D and E split ~42,000 ybp (Klyosov and Rozhanskii, 2012a).

logroup A or B. So, from whom might they have descended in

Africa, and when?

 “40 - 80 thousand years ago” (Campbell and Tishkoff,

2010)

Presupposition 3 is phrased variously: Hellenthal et al.

(2008) say, “the haplotype diversity is highest in Africans”,

(Campbell & Tishkoff, 2010), say that “Africa not only has the

highest levels of human genetic variation in the world but also

contains a considerable amount of linguistic, environmental

and cultural diversity”. In reality, highest diversity does not by

any means represent a homeland, unless the homeland has been

totally isolated and has not been affected by populations from

outside. New York City has a higher diversity than Boston, but

that doesn’t mean that New York City is a homeland for Boston.

Diversity quite commonly is a result of mixing, and Africa is a

home of mixed populations, including quite ancient populations

known presently as A0, A1, etc., plus haplogroup B, which did

not descend from haplogroup A. When it arrived in Africa, it

greatly increased the diversity there. The same is with a popula-

tion of R1b-V88, which arrived in Africa on its migratory way

along the Mediterranean Sea (Cruciani et al., 2010) and cur-

rently resides in Cameroon and Chad, also contributing to di-

versity in Africa. As it is shown below, lineages A0 do not only

predate the α-haplogroup (A1/A1b), but evolved (in terms of

Y-chromosome) independently on the latter. It is likely that A0

represent the African lineages, while the α-haplogroup with its

downstream haplogroups represent the non-African ones.

 “55 - 70 thousand years ago” (Soares et al., 2009)

 “between 40 and 70 thousand years ago” (Sahoo et al.,

2006)

 “between 35 and 89 thousand years ago” (Underhill et al.,

2000)

 “between 80 and 50 thousand years ago” (Yotova et al.,

2011)

 “between 50 and 100 thousand years ago” (Hublin, 2011)

 “between 27 - 53 and 58 - 112 thousand years ago” (Carri-

gan and Hammer, 2006)

 “around 70 - 60 thousand years ago” (Curnoe et al., 2012).

In fact, however, none of these authors seem actually to have

calculated or otherwise obtained the numbers that they cite.

Besides, at this point, there is no methodology which can cal-

culate those numbers. The numbers are taken from thin air, and

cross-cited in dozens of articles. It is astonishing to us that no

scholar has ever questioned the figures. The Out-of-Africa hy-

pothesis needed the figures, and they seem to have been pro-

vided without justification.

In fact, neither “haplogroup A” (there are now a number of

them), nor any other haplogroup could possibly have come out

of Africa 70,000 years ago, since the temporal distance between

A and all other haplogroups is at least 120,000 years.

Non-African haplogroups clearly did not descend from hap-

In short, Africa is home to truly ancient (compared to BT)

populations of various haplogroups designated presently as A,

A. A. KLYOSOV ET AL.

and other haplogroups which arrived in Africa at different times.

So, diversity by itself does not support the idea of a common

homeland in this context.

Presupposition 4 is stated clearly by Atkinson (2011) in a

recent article in which he asserts that “human genetic and phe-

notypic diversity declines with distance from Africa ··· under-

pinning support for an African origin of modern humans ··· loca l

language diversity ··· points to parallel mechanisms shaping

genetic and linguistic diversity and supports an African origin

of modern human languages”. This effort to shore up the

Out-of-Africa hypothesis also fails. Since haplogroups A and

BT diverged from the same α-haplogroup (Figure 1), this does

not mean that the younger lineage descended from the older.

Our research shows that they parallel each other such as two

teeth in the proverbial fork. They descend not from each other,

but from a common ancestor who was the α-haplogroup.

Haplogroup R1a (20,000 ybp) and haplogroup R1b (16,000

ybp) (Klyosov & Rozhanskii, 2012b; Klyosov, 2012), arose in

Central Asia (ibid.). Both are younger than haplogroup A

(120,000 ybp) but they are not descended from haplogroup A.

A boy is not a descendant of his older brother. The fact that the

Indo-European (IE) languages are younger than the click lan-

guages does not prove that IE languages descended from click

languages or that Africa is a homeland of the languages of

man.

Presupposition 5, that the earliest AMH was found in Africa,

is unconvincing for the following reasons:

1) We do not have the DNA of most fossils. Without identi-

fying the haplotypes of fossil DNA, any statement about the

relationship of fossils to present-day H. sapiens is irrelevant.

2) The oldest AMH skeletal fragments found in Africa carry

many archaic features. They were not exactly AMH, and many

clearly do not have modern H. sapiens morphology. Many

skeletal fragments are poorly dated. None of the early fossils

meet the stringent morphological criteria applicable to living H.

sapiens (Tattersall, 2009). A number of authors have argued

that the earliest hominids found in Sub-Saharan Africa had

African regional morphological features (e.g. Habgood, 1989).

Subsequent papers gradually began to claim that sub-Saharan

hominids had AMH features. This issue is controversial and

complicated; it is the subject of many articles (e.g. Rogers &

Jorde, 1995; Hanihara et al., 2003; Tattersall, 2009; Pinhasi et

al., 2011; Rightmire, 2009; Prat et al., 2011; Mellars & French,

2011) and by no means solved.

3) The AMH could have migrated to Africa from elsewhere.

If our ancestors could have migrated out of Africa, they could

equally well have migrated into Africa.

4) Few modern human skulls older than 20,000 years have

been discovered in Africa south of Ethiopia. One of the oldest

is from Hofmeyr, South Africa, dated to 36 ± 3 thousand years

ago. Still, it displays some archaic features (Grine et al., 2007,

2010), although it is the age or even slightly younger than the

bones of an AMH of 38 - 45 thousand ybp (e.g. Pinhasi et al.,

2011; Prat et al., 2011; Hoffecker, 2011; Benazzi et al., 2011;

Higham et al., 2011). Actually, the Hofmeyr skull demonstrates

that humans in Africa 36,000 years ago resembled those in

Eurasia, which leaves the question of who migrated where

unsolved.

While the Out-of-Africa hypothesis continues to be presented

as truth, it is based on questionable presumptions. It should be

noted that the earliest authors were careful in their descriptions

of the origin of Africans and non-Africans; they did not claim

that one group descended from the other. For example, Nei and

Takezaki (1996) wrote: “[Our] results indicate that Africans

are the first group of people that split from the rest of human

populations”, and “the root of the human population tree still

remains unresolved”.

The above is only a brief account of the controversies in the

anthropology of man and about the alleged African origin of H.

sapiens. In this study, we focus mainly on the DNA evidence

propounded to support the Out-of-Africa hypothesis. We have

found that none of the evidence is convincing. As the principal

methodology, we consider base (ancestral) haplotypes of hap-

logroups A0, A, and B, determine timespans to their common

ancestors as it was initiated in the preceding paper (Klyosov &

Rozhanskii, 2012a), compare their haplotypes with that of

chimpanzee MSY and show that the methodology of DNA

genealogy works even on timespans of millions of years, com-

pare ancestral nucleotides of Y-chromosomes of chimpanzee

(and the DNA fragments of some other primates) to those in

humans, based of that comparison differentiate lineages of

haplogroups A0, A/A1b, A1a and their downstream subclades,

assign the nucleotides to the α- and β-haplogroups, and finally

show that the African and non-African lineages indeed split

apart from the α-haplogroup; therefore, non-African lineages

did not descend from the African ones. Both African and

non-African lineages have evolved-in terms of their Y-chro-

mosomes—concurrently (in parallel) from their common an-

cestor who lived around 160,000 years before the present. One

more set of the African lineages, collectively called A0 hap-

logroups, has evolved independently (again, in terms of their

Y-chromosomes) on the α- and β-haplogroups as well as on

other African lineages. It seems that A0 are the most archaic

African lineages, which arose at least 180,000 ybp and possibly

much earlier.

The Current Structure of Haplogroup A

Currently, there is no unified haplogroup A. It is a loose set

of lineages in which each has its own set of SNPs and the list of

SNPs is growing. Some of them are shown below, thank to the

researchers and Institutions named in the “Materials and Meth-

ods” section.

Figure 2 shows a haplotype tree of haplogroup A. It is based

on tests collected by the FTDNA Haplogroup A Project. The

tree consists of four principal parts. The most remote branch in

the tree is the doublet of two relatives (1 and 2). They do not

have SNPs that occur in other haplogroups (ISOGG designated

their haplogroup as A0*), and have a base 22-marker haplotype

as follows

13 11 12 - 10 11 - 16 - 10 9 14 14 8 8 8 9 12 11 12 8 12 12

11 11 (A0*)

This is remote from all known haplotypes in the world; for

example, A0* has DYS438 = 16—a slow marker in which a

mutation happens about once in 45,000 years. All other hap-

logroups have DYS438 = 9-11. In other words, A0* differs

from other haplotypes by 5 to 7 mutations. This newly design-

nated haplogroup A0* differs from the deduced ancestral hap-

lotype of the composite haplogroup A described by Klyosov

and Rozhanskii (2012a) by 27 mutations:

12 11 11 - 9 11 - 10 - 10 8 14 15 7 10 8 12 13 11 16 8 13 9

11 12 (A)

The differences translate to 250,000 years, and place their

common ancestor at 190,000 ybp. With respect to time, this

A. A. KLYOSOV ET AL.

Figure 2.

A 22 marker tree of 39 haplotypes of haplogroup A. These haplotypes

are part of the FTDNA Haplogroup A Project. The upper right branch is

haplogroup A1a (presumably M31); it consists of haplotypes from

Finland, England, Switzerland, Cape Verde. Number 3—at about 4

o’clock on the figure—is from an African-American. His DNA has

close matches in Cameroon and presumably belongs to A0, which is

positive at SNP V152 (Simms et al., 2011), Four and 5 (both Afri-

can-American) are positive for L896; the former has close matches in

Ghana. One and 2 belong to close relatives who have been assigned to

haplogroup A0*. The remaining 28 haplotypes belong to haplogroup

A1b1b2b-M13/M32.

common ancestor is older than the α-haplogroup (160,000 ±

12,000 ybp). As we will see later, A0* has a different pattern of

nucleotides than α-haplogroup, which actually might coincide

with the A1/A1b haplogroup in the current nomenclature.

The A0* haplotype shown above differs from the base hap-

logroup B haplotype described in Part 1 of this study (Klyosov

& Rozhanskii, 2012a) by 29 mutations:

11 12 11 - 11 11 - 10 - 11 8 16 16 8 10 8 12 10 11 15 8 12 11

12 11 (B)

There are 286,000 years between haplogroup A0* and hap-

logroup B. Clearly, A0* could not be ancestral to haplogroup B,

or to haplogroup BT.

The upper right branch in the tree (haplotypes 6 - 11) belongs

to haplogroup A1a; it is composed mainly of European haplo-

types, and has the following base haplotype:

12 10 11 - 7 13 - 8 - 10 8 15 17 6 10 9 12 13 11 16 8 13 11

11 12 (A1a)

It differs from the ancestral base haplotype of haplogroup A

by 14 mutations (84,300 years). Using calculations based on 25

and 67 marker haplotypes, we have determined the age of the

A1a branch of about 8500 ybp. Since the age of haplogroup A

is 132,000 ± 20,000 years, and the A1a base haplotype is 14

mutations apart, their common ancestor lived 122,000 ± 15,000

ybp. This is haplogroup A within the margin of error, hence,

A1a is a downstream subclade of haplogroup A. Generally, it is

known from the phylogeny, and the haplotypes confirm it.

Haplotypes 3, 4 and 5 on Figure 2 belong to three different

lineages of A0. They differ by 12, 7 and 11 mutations, respec-

tively, from the presumed base haplotype:

12 12 11 - 10 11 - 12 - 11 8 15 15 8 10 8 0 12 11 14 8 13 8

12 12

These differences correspond to conditional

generations, or about 52 thousand years before the present.

Another way of arriving at the most recent common ancestor

(TMRCA) is using the permutation method described in

Klyosov (2009). The permutation method does not require the

base haplotype, and it is based on the sum of the squared muta-

tion differences between each allele in all the loci (22 loci in

this particular case) divided by the square of a number of hap-

lotypes (3 haplotypes in this case) and by the mutations rate

constant (0.00027 mutations per marker per 25 years). Since the

number of squared permutations in these three haplotypes was

122, we obtain 122/22/9 = 0.616 mutations per marker, and the

common ancestor lived 25 × 0.616/0.00027 = 57,000 years be-

fore the present, which is close to the above value.

1685 2167

In the 28 haplotypes which form haplogroup A1b1b2b-

M13/M32 on the left side of the tree, there is a young Saudi

Arabia branch of four haplotypes with a base haplotype as fol-

lows:

12 11 11 - 9 11 - 10 - 10 9 12 12 7 12 8 0 13 11 16 9 14 9 11 11

(A1b1b2b)

It differs from the base haplotype of the rest of the hap-

logroup by 40 mutations in the 67 marker format, and by 3

mutations in the 22 marker format. This translates to 12,300

years between their common ancestors.

Most of the haplotypes of haplogroup A in the dataset are

represented by people who report European or Middle Eastern

backgrounds. Therefore, the premise that haplogroup A almost

exclusively resides in Africa, is not accurate, at least based on

data on hand, even if they are clearly not representative. We

simply do not know the current distribution of haplogroup A

carriers around the world, and we know even less that distribu-

tion some hundred thousand years ago.

How Old Is Haplogroup A0?

Only four A0 haplotypes are currently known in the 22

marker format (numbers 1/2, 3, 4 and 5 on the tree in Figure

2):

13 11 12 - 10 11 - 16 - 10 9 14 14 8 8 8 9 12 11 12 8 12 12

11 11 (haplotype 1/2)

12 12 14 - 11 12 - 14 - 11 8 15 15 7 10 8 0 13 13 14 8 13 8

12 11 (haplotype 3)

12 12 11 - 10 11 - 11 - 11 8 15 15 8 10 8 0 11 13 14 7 13 9

12 13 (haplotype 4)

12 13 10 - 10 11 - 10 - 11 8 15 15 8 9 8 0 10 9 14 8 12 8 11

12 (haplotype 5)

Since their ancestral haplotype is unknown, we need again to

apply the permutation method (Klyosov, 2009) to determine

how deep in time their common ancestor might have lived. The

sum of the squared mutation differences between each of them

is 310, and we arrive at 310/16/22 = .881 mutations per marker

in the four A0 haplotypes. The common ancestor of the five A0

individuals lived 0.881/0.00027 × 25 = 81,550 years before the

present. This value makes sense only if all four haplotypes

belong to the same haplogroup, but we know that they don’t,

therefore, the actual figure is >81,550 ybp.

Since the haplotype of the doublet (1/2) is quite distant

from the others, we can use another way to estimate a time span

between the contemporary haplotype 1/2 and the base haplo-

type of 3, 4 and 5. They differ by 23 mutations, which corre-

spond to 186,000 years between them. Therefore, the common

ancestor for entire A0/A0* lineages lived (186,000 + 52,000)/2

202

A. A. KLYOSOV ET AL.

≈ 120,000 years ago, again assuming that these haplotypes

belong to the same haplogroup. This means that the actual time

to their common ancestor is significantly higher than 81,550

ybp. The common ancestor of A0 and the other African haplo-

types lived more than 180,000 years before the present

(Klyosov & Rozhanskii, 2011).

Let us move to the main subject of this study, namely, what

the Y-chromosome nucleotides and SNPs show about the con-

nection between haplogroup BT and haplogroup A. As we have

shown above, haplogroup A cannot be ancestral to haplogroup

BT. The two lineages diverged independently from the α-hap-

logroup. Additionally, one of several lineages (currently de-

signated as A0 and A0*) evolved independently of the hap-

logroup A.

Nucleotides and SNPs in the Y-Chromosome of

H. Sapiens and the Y-Chromosome and/or DNA

Fragments of Some Primates

As the principal methodology of this study we consider nu-

cleotides and SNPs in

1) some living primates of the family Hominidae (e.g. chim-

panzee, gorilla, orangutan) and the macaque (of the family

Cercopithecidae, tribe Papionini)

2) newly discovered lineages in a variety of haplogroups A,

3) haplogroup BT and its descendant haplogroups R1a and

R1b (as specific examples of Europeoids [Caucasoids]).

First, we should consider whether or not we are correct when

we choose to compare nucleotides and SNPs in living primates

and living humans. We can assume that human and chimpanzee

genomes diverged 6.5 million years ago (cit. Green et al., 2010)

or 6 million years ago (Hughes et al., 2012; Scally et al., 2012),

or 5 to 7 million years ago (Prüfer et al., 2012). The tribe Papi-

onini emerged 6 - 8 million years ago and the Hominidae fam-

ily emerged 13 - 18 million years ago (Perelman et al., 2011).

Following Cruciani et al. (2011) and Scally et al. (2012), and

references therein, we can take 1.0 × 10−9 single-nucleotide

substitutions per base per year as an estimate of the mutation

rate in the Y-chromosome. This tells us that in 6.5 million years

a nucleotide in the Y-chromosome would mutate 0.013 - 0.015,

or between 1.3% and 1.5%. Whatever the exact figure, it is

clear that it is safe to use primate nucleotides as proxies for

nucleotides in present day humans. We know that chimpanzee

Y-chromosomes and human Y-chromosomes are remarkably

divergent in structure and gene content (Hughes et al., 2010);

however, nucleotides in the Y-chromosome positions we have

considered (see below) appear to have retained their structure

quite remarkably (see Figure 3).

Figure 3 shows a comparison of a 97-nucleotide human

DNA fragment with the respective MSY fragment in chimpan-

zee and the DNA fragments from the whole genome shotgus

sequence of gorilla, pongo, and macaque. Eighty seven percent

(84 of the 97 nucleotides) are identical in humans and in these

primates (see Figure 3). The fragments contain nucleotide C

(position 51) which becomes SNP P82 (mutation CA) con-

verting haplogroup A1 into A1a. Other SNPs which mark this

conversion are M31, V4, V14, and V25.

One can see that the ancestral nucleotides in the DNA of

these primates have been stable for 15 million years or so; thus,

they can be employed for comparison with the respective nu-

cleotides in human Y-chromosomes.

Since the chimpanzee genome is by many accounts the

closest to humans and the most thoroughly studied, and since

the chimpanzee genome sequence is available (see Materials

and Methods), it was employed in our further studies.

How Long Ago Did the Split between the

Common Ancestor of Chimpanzees and

Humans Occur?

To answer this question we have employed slow markers

available for the 22-marker panel (Klyosov & Rozhanskii,

2012a); the respective alleles were determined for chimpanzee

and human MSYs (see Materials and Methods). Overall, 16

markers out of the 22 were recovered in the chimpanzee

Y-chromosome, as follows: DYS 426, 388, 392, 455, 438, 578,

641, 472, 425, 594, 436, 490, 617, 568, 640, 492. Six other

markers in chimpanzee MSY did not have homology with the

human MSY as a result of a rearrangements of genome that

occurred during the past~6.5 million years. Therefore, the 16-

marker haplotype of present-day chimpanzee MSY was ana-

lyzed (see Materials and Methods) as follows:

8 15 10 4 5 9 10 5 10 4 4 7 4 4 8 9

In present-day H. sapiens males the respective haplotype is

as follows. Only the predominant alleles in all haplogroups,

particularly in the oldest ones, were included (see Materials and

Methods):

11 12 11 11 10 8 10 8 12 10 12 12 12 11 11 11

The mutation rate constant for those 16 markers equals .00410-

Figure 3.

Comparison of the MSY fragments (1 - 97) from Humans and Chimpanzee, and the DNA fragments in the genome of Gorilla, Pongo and

Macaque (whole genome shotgun sequence), along with a consensus tree fitting mutation patterns (inset).

A. A. KLYOSOV ET AL.

AK mutations per haplotype (Klyosov, 2011). The two haplo-

types differ by 64 mutations, or, by 4 mutations per marker on

average. The correction for back mutations is determined as (1

+ e4)/2 = 28 (ibid.). This means that the calculated time to the

common ancestor of H. sapiens and Pan troglodytes must be

multiplied by 28. The sixty-four mutation difference between the

MSY human and chimpanzee haplotypes computes to a common

ancestor equal to 64 0.004115,610437,080 conditional

generations (the arrow indicates a correction for back muta-

tions), or 10.9 ± 1.7 million years distance between the present

day Y-chromosomes of chimpanzees and humans. In other

words, the split occurred 5.5 ± 0.9 million years ago (the ob-

tained timespan should be divided by two, since it separates the

present day MSYs). This fits the numbers which are commonly

cited by geneticists, e.g. 5.6 - 8.3 million years ago (Green et al.,

2010) or 3.9 - 5.9 million years ago (Sun et al., 2011), or the

figures of 6 and 5 - 7 million years ago, given in the preceding

section of this paper. This result also shows that calculations

using slow mutated markers can be employed even for millions

of years back.

Nucleotides and SNPs in the Y-Chromosomes of

Chimpanzee and Humans

Let us follow some mutations in the Y-chromosome from

chimpanzee to several principal human lineages: A0, A1, A1a,

A1b, and the β-haplogroup (which is close to or identical with

BT). This might give us a clue to the direction of mutational

flow and, therefore, to which lineage was derived from which.

Here we have to adhere to one condition: we cannot call anyone

of lineages African unless we know that it actually originated in

Africa. We know only where the majority of bearers of the

subclades presently live. For example, all 11 individuals as-

signed to the A0 haplogroup live in the United States, with

“unknown origin” marked on the list in the Haplogroup A Pro-

ject (June 2012); one is marked as African American. In other

words, we simply do not know where their ancestors lived, say,

100,000 years ago; we assume that they lived in Africa, how-

ever, it is not enough to determine that “their common ancestor

arose in Africa”.

Seventeen individuals assigned to the A1a subclade and its

four sub-lineages, currently live in England, Switzerland,

Finland, Cape Verde, and the US. Most of them marked un-

known origin; however, some of them indicated European

countries as origin of their recent ancestors. Forty-six bearers of

A1b1 and its downstream subclades currently live in England,

Ireland, Scotland, Italy, Algeria, Turkey, Kuwait, Saudi Arabia,

Tunisia (one), Chad (one), South Africa (one), the US. None of

the individuals in the project belongs to upstream A1 or A1b

subclades. Therefore, SNPs V168, P108 and V221, which are

actually observed in BT (β-haplogroup) and down to hap-

logroups R1a and R1b, as well as in parallel downstream sub-

clades of A1b, could have been inherited as mutations from a

common α-haplogroup ancestor of both sides of the bifurca-

tion shown in Figure 1.

In the description below, one should take into account that

haplogroup A is a collective, a tentative grouping, which in-

cludes all that is not in haplogroup BT. Indexes, which are

(tentatively) assigned to haplogroup A subclades, change every

few months or even weeks. There is nothing African in the

indexes of the subclades. We can only assume, for the sake of

explanation, that 1) the α-haplogroup in Figure 1 corresponds

to A1/A1b haplogroups in the current classification; 2) one side

of the bifurcation represented in Figure 1 leads to the

β-haplogroup (currently BT or sometimes BR in the classifica-

tion); and 3) another leads to the “African” subclades, hap-

logroups A1a and downstream subclades of A1b. We can as-

sume that the latter are “African”, since their SNP mutations

are not observed in the β-haplogroup, including Europeoids.

The word “African” is in the quotations marks since we actu-

ally do not know where their common ancestors lived some

100,000 ybp or before (or after) that.

A0 lineages. There are two principal types of A0 lineages: 1)

those which retain the nucleotides found in MSY of living

chimpanzee (Table 1), and 2) those which contain specific

SNPs compared with the ancestral nucleotide in chimpanzees (Ta-

ble 2). These two types make haplogroup A0 very distinct from

those (Africans and non-Africans) ancestors of which descended

from the α-haplogroup. For the most cases A1 A1bBT

bearers, for example, have those 1)—type nucleotides mutated

into the respective SNPs; and 2)—type nucleotides retained as

ancestral in chimpanzee. It does not mean that the A0 bearers

are closer to chimpanzees than to other humans. It means that

the Y-chromosome in A0 bearers evolved (mutated) independ-

ently compared to other “African” and “non-African” lineages.

Besides, as shown above, A0 is significantly older than the α-

haplogroup.

As a result, H. sapiens living today have three identified thus

far principal MSY lineages: 1) “Common African” (part of

subclades of haplogroup A, branched from the α-haplogroup

and formed the left-hand bifurcation in Figure 1); 2) “non-

African” (descendants of the β-haplogroup, branched from the

α-haplogroup and formed the right-hand bifurcation in Figure

1); and 3) bearers of A0 lineages. Those three principal MSY

lineages are very different in terms of their Y-chromosomes,

however, they are brought much closer together by maternal

part of their DNA, so their resulting genome is adjusted with

every new generation.

In addition to those listed in Table 1, the following SNPs

have been assigned to the BT haplogroup in the current classi-

fication, and may be directly related to the α-haplogroup: L413,

L418, L438, L440, L604, L957, L962, L969, L970, L971, L977,

L1060, L1061, L1062, SRY10831.1, M42, M94, M139, M299,

P97, PK1.

The α-haplogroup. Although no individuals bearing A1 or

A1b SNPs are listed in the FTDNA Haplogroup A Project or in

the Walk Through YDNA Project, it can be safely assumed,

based on the SNPs patterns, that the α-haplogroup includes A1

and A1b subclades. Haplogroup A (in its entirety) is a hap-

logroup which split from the α-haplogroup some time after

160,000 ± 12,000 ybp; haplogroup A contains many mutated

nucleotides (SNPs) which are not mutated in A0 lineages. The

mutated SNPs in the α-haplogroup (A1/A1b) are inherited not

only by the African subclades but also by the non-African sub-

clades.

All 77 mutations shown in Table 1 represent SNPs for the α-

and β-haplogroups. The SNPs assigned to A1b are P108 and

V221; the SNPs assigned to BT are V29, V59, V64, V235 (and

those immediately below Table 1), total 27 SNP’s. The re-

maining 50 mutations in Table 1 are the SNPs assigned to A1,

according to the current classification. SNPs P305 and L986 are

mistakenly assigned to the A0 subclades in the current version

of ISOGG-2012 (June 2012); mistakenly, because they do not

204

A. A. KLYOSOV ET AL.

Table 1.

Ancestral nucleotides in chimpanzee MSY which are retained in A0

lineages, but are mutated in the α-haplogroups (i.e. in A1/A1b/BT).

Nucleotides SNP

Chimp A0 α-haplogroup

C C T P108

A A G P305

A A C L985

G G A L986

T T A L989

A A G L990

A A T L1002

G G del L1003

T T C L1004

A A G L1009

C C A L1053

T T C L1085

G G C L1089

G G C L1090

A A G L1093

C C A L1098

A A G L1099

T T C L1101

C C T L1105

C C A L1013

G G A L1114

A A C L1116

T T C L1118

G G T L1120

C C T L1123

T T C L1124

A A G L1125

A A G L1127

C C T L1128

T T G L1130

A A G L1132

C C A L1135

A A G L1136

C C T L1137

Continued

C C T L1142

A A G L1143

C C T L1145

A A G L1150

TAGG TAGG del L1153

G G C L1155

C C T V21

A A G V29

G G A V41

C C T V54

C C T V59

T T A V64

A A G V161

G G A V168

C C G V171

A A G V174

T T G V203

G G T V221

A A G V235

G G T V238

C C T V241

A A G V250

have the respective SNPs in A0, those SNPs belong to the

α-haplogroup (see Table 1).

Table 2 lists SNPs which belong to the A0 lineages; those

nucleotides are retained ancestral in the α-haplogroup. It again

shows the principal difference between A0 and BT.

In addition to the mutated nucleotides listed in Table 2, the

following ancestral nucleotides are mutated in A0 lineages but

retained in the α-haplogroup:

A—L1086, L1094, L1102, L1109, L1112, L1113, L1117,

V79, V81, V141, V223, V242,

C—L1088, L1097, L1100, L1103, L1104, L1107, L1108,

L1111, V164,

G—P114, L1087, L1091, L1096, L1106, L1115, L1119,

V139,

del—V152.

A total 62 SNPs in A0 lineages are listed above plus 30 more

(L981, L983, L988, L994, L1007, L1014, L1070, L1072,

L1073, L1075, L1076, L1078, L1079, L1080, L1081, L1082,

V150, V151, V153, V157, V158, V159, V161.1, V162, V164,

V169, V170, V181, V195, V203) which are currently (June

2012) identified and listed in public sources (see Materials and

Methods). The difference between the listed 52 mutations in

A1/A1b (α-haplogroup) and the 92 mutations in A0 lineages

compared to the ancestral nucleotides in chimpanzee MSY

A. A. KLYOSOV ET AL.

Table 2.

Ancestral nucleotides in chimpanzees which 1) are retained in the α-

haplogroup



A1 A1bBT and 2) show a mutation in A0 lineages.

Nucleotides SNP

Chimp A0 α-haplogroup

A G A L529

A T A L896

C A C L982

G T G L984

C A C L991

A C A L993

T C T L995

TTA del TTA L997

T G T L998

C T C L999

C A C L1000

G T G L1001

A G A L1005

A T A L1006

C A C L1008

T C T L1010

C T C L1012

T C T L1016

T C T L1018

G A G V148

T G T V149

A G A V154

G A G V166

G A G V172

T G T V173

A T A V177

G T G V196

A G A V225

G A G V229

C T C V233

G A G V239

shows that A0 lineages and the α-haplogroup are remote from

each other; however, these data should not be used for calcula-

tions of age, because not all SNPs have been identified or as-

signed as yet.

A1a subclade. The A1a subclade is downstream from the A1

subclade; thus far, it has five SNPs identified (M31, P82, V4,

V14, V25) which were not inherited by the β-haplogroup. It

seems that A1a split from the α-haplogroup between 160,000

and 60,000 ybp, and eventually ended up in Africa, Europe,

Asia (see above). Most identified bearers of A1a’s currently

live in Europe or the US; needless to say, this does not tell us

Subclades downstream from haplogrou

much about where the subclade originated.

p A1b. The SNPs

tly, only one bearer of the A1b1 subclade is listed in

y on nucleotides in

nstream SNP-mutations occurred in the

tides and the

these subclades (e.g. A1b1, A1b1a and A1b1b2-M13) are not

observed in the BT haplogroups, therefore, it appears that bear-

ers of these subclades ended up in Africa some time after their

ancestors split from the α-haplogroup (A1/A1b). However,

even this suggestion cannot be certain since many A1b1b2-

M13a bearers currently live in England, Ireland, Scotland, Italy,

Turkey, Algeria, Kuwait, Saudi Arabia, as well as in Tunisia

and Chad (cf. the FTDNA Haplogroup A Project). We do not

know when or where the subclades downstream from A1b

arose.

Curren

e FTDNA Haplogroup A Project (as origin unknown). The

majority of identified bearers of the haplogroup A subclades

belong to A1b1b2-M13 (60%); 23% belong to the A1a sub-

clade, 15% belong to the A0 subclades).

Once we have established that we can rel

impanzee MSY which are either inherited or generally intact

in the human Y-chromosome, or which mutate into the respect-

tive SNPs in certain lineages of human male haplogroups, we

can try to interpret the diagram in Figure 1 in terms of the an-

cestral nucleotide and acquired SNPs flow. Figure 1 shows that

incoming nucleotides of chimpanzee (from below on the dia-

gram) to the α-haplogroup should either flow as unchanged,

ancestral, non-mutated, or as mutated into the respective SNPs

into the α-haplogroup and then, mutated, to the both sides of the

tree. Therefore, those ancestral (from chimpanzee) and the

SNP-mutated (in the α-haplogroup) nucleotides are expected to

be present in both “common Africans” (not A0 bearers) and all

non-Africans. It is exactly what is observed. It does not mean

that non-Africans descended from an African common ancestor.

Those African and non-African branches of the tree are parallel

ones (see Figure 1).

Additionally, dow

th branches after they split from the α-haplogroup. Those

include 1) SNPs of the A1a subclade and its (future) down-

stream subclades, as well as downstream subclades of A1b,

which are expected to be observed in Africa. However, only

few of them have been identified there thus far due to a poor

representation of African haplotypes. Those SNPs have not

been found in bearers of haplogroups B through T, including

most of non-Africans. Those also include 2) relatively recent

SNPs in the descendents of the β-haplogroup, which (SNPs)

have resulted in the 19 principal haplogroups (B to T) down-

stream of the β-haplogroup. Those SNPs, of course, cannot be

found among bearers of haplogroups A and A0.

What is the pattern of intact (ancestral) nucleo

llow-up SNPs? First, we will look at two A0 lineages, actu-

ally identified in the WTY Project, and placed on the ISOGG-

2012 list as four subclades (A0, A0a, A0a1, and A0b). They are

not associated with the α-haplogroup. When we compare them

at 346 nucleotide sites, they differ from each other at 36 loci.

The two A0 lineages differ from each other in three blocks of

SNPs (between L92.2 and L348.2, between L979 and L1017,

and between L1036 and L1058), and in 153 sites—almost half

of the 346 nucleotides—they differ from the BT lineage. A pat-

tern of STR-mutations show that A0 lineages are much more

ancient than the α-haplogroup (Rozhanskii & Klyosov, 2011),

and did not descend from it. The data shown above suggest that

the α-haplogroup was the handle of the MSY fork from which

the “common African” and non-African lineages diverged and

evolved in parallel (see Figure 1); this pattern adequately de-

206

A. A. KLYOSOV ET AL.

scribes the evolution of the Y-chromosome of H. sapiens for

the last 160,000 years. This pattern leaves no room for the

Out-of-Africa hypothesis.

The deduced ancestral (base) haplotypes of haplogroups A

hat ana-

Conclusion

Our consideration o through T, and our

haplotypes, we

nucleo-

tid

Materials and Methods

The SNPs cite1 and 2 and the

of the DNA with certain SNPs or STRs

/gb2/gbrowse/hschrY/ as follows:

e.ftdna.com/index.php?name=Draft&parent=root and

d B are shown above; the estimated time to their common

ancestors is between 132,000 ± 20,000 and 46,000 ± 5,000 years,

respectively (Klyosov & Rozhanskii, 2012a). These two hap-

lotypes differ from each other by as many as 18 mutations,

which translates to 123,000 years between them. Their common

ancestor lived approximately 160,000 ybp (Klyosov & Roz-

hanskii, 2012a). One can see that haplogroup B could not possi-

bly have descended from haplogroup A. However, the problem

would be resolved if the two had a common ancestor who lived

160,000 ybp. We do not know where this common ancestor

lived; there certainly is no indication that he lived in Africa. Ne-

anderthals did not live in Africa and, as it is known, did not have

a melanin-rich skin. Thus, it is not necessary to presume that all

lineages of the genus Homo had their origin in Africa.

Based on palaeoarchaeological evidence, it appears t

mically modern humans are likely to have originated some-

where in the vast territory from West Europe across the Russian

Plain in the east, and to the Levant in the south. Each of these

regions is renowned for the age of the skeletal remains of mod-

ern humans dating back to 45,000 - 40,000 ybp (for the latest

references see Highham et al., 2011; Benazzi et al., 2011).

f haplogroups A

alysis of the dynamics of the Y-chromosome nucleotide flow

from primates to humans during the evolution of genus Homo

has shown that a common ancestor of the majority of present

day human males, both Africans and non-Africans, lived

160,000 ± 12,000 years ago. This common ancestor has been

identified as belonging to the α-haplogroup, which is equiva-

lent or close to haplogroups A1/A1b in the current phylogeny.

The archaic lineages (currently designated A0) descend from

ancestor who lived at least 180,000 years ago (or much ear-

lier). The α-haplogroup and the A0 lineages have nucleotide

patterns that are distinct from each other, and both partly retain

ancestral MSY chimpanzee nucleotides and partly have them

mutated into the respective SNPs. Our research has shown that

at least 90% of chimpanzee MSY nucleotides are the same as

the nucleotides of living H. sapiens males. This comparison

points up the areas of change in H. sapiens, which allows us to

use chimpanzee MSY as a proxy for genus Homo’s common α-

haplogroup ancestor. It is clear that when they are compared to

loci in the DNA of other primates, such as gorillas, orangutans,

and macaques, many human Y-chromosome loci have been

conserved from our common ancestor.

When we studied slow mutating 16-marker

scovered that chimpanzees and present day humans had a

common ancestor 5.5 ± 0.9 million years before the present.

This date is in agreement with dates obtained in genome studies.

It is important, since it shows that the DNA genealogy ap-

proach can be extended to millions of years in depth.

The results of our analysis of haplotypes, conserved

es, and SNPs suggest that there is no reason to believe that

non-Africans (haplogroup BT and its downstream haplogroups)

descended from haplogroups A0, A1a, or other African hap-

logroups. These data are adequately described by a model

which shows that both the African lineages and non-African

ones diverged from the α-haplogroup approximately 160,000

years before the present and that the Y-chromosomes of the two

groups have evolved independently since then. Of course, the

Y-chromosome constitutes only a small part of the whole ge-

nome, and the term “evolve” here is related to the human MSY

only. It can serve, however, a very useful “probe” to trace the

human evolution with all reservations concerning the genome.

We have no indication of where the common ancestor of the α-

haplogroup lived; he could just as easily have been from

Europe, Asia, or the Middle East, as from Africa. We believe,

however, that only the A0 lineages represent the “truly African”

autochthonous inhabitants (along with the respective female

lineages), and interbreeding with them of incoming lineages of

haplogroups A and B (as well as some lineages of haplogroups

E, R1b, etc.), again, with the respective female lineages, created

the very diverse current African population. Only further stud-

ies will show whether this hypothesis is valid.

We believe that all the presuppositions of the Out-of-Africa

pothesis fail to hold up under simple scrutiny. This study

shows that the Out-of-Africa hypothesis has not been ade-

quately substantiated. The common assertion that “anatomically

modern humans came out of Africa some 70,000 years ago” has

never been convincingly calculated or obtained otherwise. The

Out-of-Africa hypothesis has never been proved; our research

suggests that it is incorrect with respect to anatomically modern

humans.

d in this study (see, e.g. Tables

xt) were identified by Thomas Krahn of FTDNA Genomics

Research Center (indicated by beginning letter L, such as L985),

Rozaria Scozzari and Fulvio Cruciani of Universita La Sapi-

enza, Rome, Italy (letter V), Peter Underhill of Stanford Uni-

versity (letter M) and Michael Hammer of University of Ari-

zona (letter P) and publicly available in various databases (see

below). Since sequences of extended fragments of Y-chro-

mosome are published in databases only for humans, chimpan-

zee, and macaque, search for homologous fragments for gorilla

and orangutan has been conducted in genomes of the primates,

listed in the European Nucleotide Archive (ENA) database,

employing Whole Genome Shotgun (WGS). Human and pri-

mate gene sequences were aligned using the National Center

for Biotechnology Information (NCBI) GenBank and ENA (the

links are listed below).

Search for fragments

human Y-chromosome has been conducted using the FTD-

NAY-chromosome Browser

http://ymap.ftdna.com/cgi-bin

(1) introduce the target SNP or STR into the field Landmark or

Region, click on Search, chose a size of the target fragment

(100 bp is recommended for an SNP), copy that fragment and

find a homologous one in GenBank or ENA, using option

BLAST. SNPs in particular haplogroups were those identified

at sites

http://ytre

http://www.isogg.org/tree/. Haplotypes of haplogroup A to

compose the tree in Figure 2 are listed in the FTDNA Project.

The base haplotypes of haplogroup A and B were determined in

(Klyosov & Rozhanskii, 2012a). Repeat motifs for the STRs

(http://www.smgf.org/ychromoso me/marker_details.jspx? mar

er and http://www.genebase.com/in/dnaMarkerDetail.php) are

A. A. KLYOSOV ET AL.

listed below:

DYS426 = 11

TGAAAGCATGACCACTTCATT

n repeats (GTT) in the greatest number of haplogroups:

Chimpanzee (Y-Chromosome)

ght repeats (GTT)]

e (GTT)7 on the 14th chromosome,

DYS388 = 12

TGATTAGCCGTTTAGCGATAT

test number of haplogrou-

Chimpanzee (Y-Chromosome)

DYS392 = 11

GTCATCGCAGTGGCCCAAGTGA

repeats (TAT) in the greatest number of haplogroups:

CCCAAGTAA

GTTGCTCCA

GAGAATGATACTGCCTAAGCC

AAGGCTGCAGTGAGCTGTGAT

f hap-

lo ups world-

GCCTAAGCC

AGTGTGATC

CACATTGTTGTTAAGCCCAGC

CAATCTCCCTGTGGTCGGGGC

r of hap-

lo s in haplogroups world-

osome has no DYS454

GTGGGGAATAGTTGAACGGTA

TTTTCTTTTCTTTTCTTTTCT

CACCACAACCTCCACTTCCCAGGTTCAAGC

CTCAAAGTA

TATTGTGTTGTTGTTGTTGTTGTTGTTGTT

GTTGTTGTTGACACAAAGTCTCGTCTTGTC

ACC

[Eleve

ong 41 base haplotypes in haplogroups world-wide there are

33 with the allele 11 (including the beta-haplogroup), and eight

with 12 (mainly haplogroup P and its downstream haplogroups)

(Klyosov & Rozhanskii, 2012)]

CTCAAAGTATGAAAGCATGACCACTTCATT

TAGTTGTTTTTTTGTTGTTGTTGTTGTTGT

TGTTGTTGACACAAAGTCTCGTCTTGTCAC

[Ei

NOTE: Macaques hav

angutans have (GTT)7 on the 17th chromosome

GAATTCATG

ATACATATTATGAAACATTATTATTATTAT

TATTATTATTATTATTATTATTTGAGACGG

ACTCTCGCTCTGTCGCCCAG

[Twelve repeats (ATT) in the grea

: among 41 base haplotypes in haplogroups world-wide there

are 28 with the allele 12 (including the beta-haplogroup), seven

with 13, two with 14 (I and I1), one 16, one 15 (J1 and J2, re-

spectively), one 11 (A), and one with 10 (B2a2) (Klyosov &

Rozhanskii, 2012)].

GAATTCATGTGAGTTAGCCGTTTAGCGATA

TATACATATTATGAAACATTATTATTATAT

ATTATTATTATTATTATTATTATTATTATT

GAGACGGACTCTCGCTCTGTCGCCCAG

[15 repeats (ATT)]

TAGAGGCA

TCTTGCAACATCTCCATCCATGTTGCTCCA

AAGGACCCAATTTTACTGTAAATGGTTGTA

TAGTATTTTATGGTCTACATAGACCATATT

TACCATATGTTCATCCATATTTTCTTCATT

AATCTAGCTTTTAAAAACAACTAATTTGAT

TTCAAGTGTTTGTTATTTAAAAGCCAAGAA

GGAAAACAAATTTTTTTCTTGTATCACCAT

TTATTTATTATTATTATTATTATTATTATT

ATTATTATTTACTAAGGAATGGGATTGGTA

GGTC

[Eleven

ong 41 base haplotypes in haplogroups world-wide there are

27 with the allele 11 (including the beta-haplogroup), six with

13, three with 12, three with 14, one with 10 (R2) and one with

7 (D3a) (Klyosov & Rozhanskii, 2012)].

Chimpanzee (Y-Chromosome)

TAGAGGCAGTCATTGCAGTGG

TCTTGCAACATCTCCATCCAT

AAGGACCCAATTTTACTGTAAATGGTTGTA

TAGTATTTTATGGTCTACATAGACCATATT

TACCATATGTTCGTCCATATTTTCTTCATT

AATCTAGCTTTTAAAAACAACTAATTTGAT

TTCAAGTGTTTGTTATTTAAAAGCCAAGAA

GGAAAACAATTTTTTTCTTGTATCACCACT

TATTTATTATTATTATTATTATTATTATTA

TTATTTACTAAGGAATGGGATTGGTAGGT

en repeats (TAT)]

DYS455 = 11

CTGAGCCGA

CACAAGGTC

CACCCGAGGGCACTCCAGCCTGGGCAACAC

TGTGAGACCATATATCTAAAATAAATAAAT

AAATAAATAAATAAATAAATAAAT AAATAA

ATAACGGAAGAACACTCGTTTCCACCCC

[Eleven repeats (AAAT) in the greatest number o

groups: among 41 base haplotypes in haplogro

ide there are 33 with the allele 11, four with 10, two with 9,

and one with 8 (I1) (Klyosov & Rozhanskii, 2012)].

Chimpanzee (Y-Chromosome)

CTGAGCCGAGAGAATGATACT

CACAAGGTCAAGGCTGCAGTG

ACCCGAGGGCACTCCAGCCTGGGCAACACT

GTGAGAGCATATATCTAAAATAAATAAATA

AATAACGGAAGAA

[4 repeats (AAAT]

YS454 = 11

GACTGACCT

AACATATCA

ACAGGCAAAAGCAAAATA AATAAATAAATA

AATAAATAAATAAATAAATAAATA AATAAC

CTAGGTGCTAATCCAAGTGATATGTTACAA

TGTTTCCTGTTGACACAACCCAACCTGGGT

GAAGTGAAGAGCTACATGTC

[Eleven repeats (AAAT) in the greatest numbe

groups: among 41 base haplotype

ide there are 32 with the allele 11, eight with 12, and one with

13 (T1a) (Klyosov & Rozhanskii, 2012)].

Chimpanzee (Y-Chromosome)

NOTE: The chimpanzee Y-Chrom

homologous fragments.

DYS438 = 10

CCAAAATTA

AACAGTATA

TTTCTTTTCTTTTCTTTTCTTTTCTTTTCT

ATTTGAAATGGAGTTTCACTCTTGTTGCCC

AGGCTGAAATGCAATGGTGTGATCTCGACT

208

A. A. KLYOSOV ET AL.

GATTCTCCTGCATCAGCCTCCCAGGTAGCT

GGGATTATAGGCGTCTGCCACCACGCCCAG

CTAATTTTTTGTGTTTTTAGTAGAGACAGG

GTTTCACCATGTTGGTGAGGCTGGTCTCGA

ACTCCAGACCCTGGGTGATC

[Ten repeats (TTTTC) in the greatest number of haplogroups:

am there are

27 ta-haplogroup), eight with

TTCTTTTGT

CACTCTTGT

CATTCAAATCCTCTCCCACT

TAAATAAATAAATAAATAAATA

AATAAATAAATAAAAAGCCTTT

f hap-

lo world-

wncluding the beta-hap-

osome has no DYS531

ACTCTAGCCTGGATGACACAAC

ATCTCAAATAAATAAATAAATA

pes out

of; 10 in F;

anskii, 2012)].

TGACAGAAC

AAATAAATA

GACAACAATTGTGTGTAAGTGACAAAATGT

AACTGAAAATCAT

TTTTGTTTTGTTTTG

TGTTTTGTTTTGTTTTGTTTTT

TTCTTGCTCTGTCACCC

plotypes

ou & Roz-

GAGACTCTTCCATCTAAATAA

ATAAATAAATAAATAAATAAAT

types out

of Rozhan-

GCCCGCTGCTCTCCAGCCTGG

TCTAAATAA

ATAAATAAAT

CACTCCAGCCTGGCG

AAT

TAATAATAATAAT GCCTCTTTG

AGTGCCTC

groups]

TAATAGTAAT

TTGCTGAAC

llow the

-chromo-

some, however, shows (TAA)4 on the 3rd chromosome.

ong 41 base haplotypes in haplogroups world-wide

with the allele 10 (including the be

, and six with 9 (Klyosov & Rozhanskii, 2012)].

Chimpanzee (Y-Chromosome)

CCAAAATTAGTGGGGAATAGTTGAATGGT

AACAGTATATTTTCTTTTCTT

TTTCTATTTGAAATGGAGTTT

TGCCCAGGCTGAAATGCAATGGTGTGATCT

CGACTCACCACAACCTCCACTTCCCAGGTT

CAAGCGATTCTCCTGCATCAGCCTCCCAGG

TAGCTGGGATTATAGGCGTCTGCCACCATG

CCCAGCTAATTTTTTGTGTTTTTAGTAGAG

ACAGGTTTTCACCATGTTGGTGAGGCTGGT

CTTGAACTCCAGACCCTGGGTGATC

[Repeats (TTTTC)3(TTTTG)1(TTTTC)1] [described in (Gus

ao et al., 2002)]

YS531 = 11

GACCCACTGG

GCAAAAAA

AATAAATA

CGTCTACAAAGAAAGGGAGCA

[Eleven repeats (AAAT) in the greatest number o

groups: among 41 base haplotypes in haplogroups

ide there are 30 with the allele 11 (i

group), 10 with 10, and one with 12 (I2*) (Klyosov & Roz-

hanskii, 2012)].

Chimpanzee (Y-Chromosome)

GACCCACTGGCATCCAAATAACCTCCCTTG

GCAAAAAAAAAA…

NOTE: The chimpanzee Y-Chrom

mologous fragments.

YS578 = 8

GAGGCGGAACTTTCAGTGAGCCGAGATCAC

GCCACTCC

AAAACTCC

AATAAATAAATAAATAAA GTAAGTAAGACA

GACAACAACTGTGTGTAAGTGACAAAATGT

CCAGGGTTGTTGAAGC

[Eight repeats (AAAT) in 36 haplogroup base haploty

41 world-wide, except 9 in C3, F3 and O, NO and O

d 7 in J2 (Klyosov & Rozhan

Chimpanzee (Y-Chromosome)

GAGGCGGAACTTTCAGTGAGCCGAGATCGC

GCCACTCCGCTCTAGCCTGGG

AAGACTCCATCTTAAATAAAT

AATAAATAAATAAATAAAT AAATAAAGACA

CCAGGGTTGTTGAAGC

[Nine repeats (AAAT)]

YS590 = 8

GAACATAGTCGGGCT

AGTTGGGCAAGTTTT

TTTTGTTT

GAGACGGA

[Eight repeats (TTTTG) in 39 haplogroup base ha

t of 41 world-wide, except 7 in A and L (Klyosov

nskii, 2012)].

himpanzee (Y-Chromosome)

NOTE: The chimpanzee Y-Chromosome has no DYS590

homologous fragments.

DYS641 = 10

CTTGAGCCCAGGAAGCATAGGTTGCAGTGA

GCTGAGATCGCCTGCTGCTCTCCAGCCTGG

TGATAGAGA

ATAAATAA

AAATGCTCCACAGCTAGGTGATATTGTTAA

TTGTTAGGTAACAGTTATTACAGACAAGAA

AGCCTAATTTACAAATAAAGGACAAAATTC

ATCGTGTGG

[Ten repeats (TAAA) in 39 haplogroup base haplo

41 world-wide, except 7 in NO and O (Klyosov &

ii, 2012)].

himpanzee (Y-Chromosome)

CTTGAGCCCAGGAAGCAGAGGTTGCAGTGA

GCTGAGATT

TGATAGAGAGAGACTCTTCCG

ATAAATAAATAAATAAAT AA

AAAAAGTTGCTCCACAGCTAGGTGATATTG

TTAATTGTTAGGTAACAGTTATTACAGACA

AGAAAGCCTAATTTACAAATCCAGGACAAA

ATTGCATCGTGTGG

[Ten repeats (TAAA)]

YS472 = 8

AGATTGTCCCACCT

ACACAGGAAGGTTCCATCTCAAATAGT

AATAATAA

CTGAACAC

[Eight repeats (AAT) in base haplotypes of all haplo

himpanzee (Y-Chromosome)

AGATTGTCCCACCTGCACTCCAGCCTGGCG

ACACAGGAAGGTTCCATCTCAAATAGTAAT

AATAATAATAATGATAATAA

AATAATAATAATAATGCCTCT

ACAGTGCCTC

[Five repeats (AAT) in this particular case if we fo

man homology].

NOTE: Macaques does not show homology on Y

A. A. KLYOSOV ET AL.

he 11th chromosome.

CTATTGGAGGAGGAGAACCCT

AGAAGAAGAGAGAAACAGGCT

pes out

TATAGAAGGCAAGCAAGCTAA

GAGAACCCT

GAAACAGGCT

AATAAATCTAAAGCACATAAA

AATAAAATAAAATAAAATAAAA

of hap-

lo world-

weta-hap-

loh 13 (Klyosov &

GCACATAAA

TAAAAAAAAC

AGCAG

TGTTGTTGTTGT

TATCACCTCTAACGCAGCTCG

CTGTGTCCTGCTTCCATTGGC

f hap-

lo s world-

we beta-hap-

lolyosov & Rozhanskii, 2012)].

TGTCCTGCT

ATTATTATTATT

AGTCTTGCTCTGTCACCCAGGC

GTGGCGTGATCTCAGCTCAGT

of hap-

lo s world-

wbeta-hap-

lo3, three with 15 and one with 16 (Klyosov

AGTCTTGCTCTGTCAC

ATCTCGG

TTTCTATTGCAGCA

ACATAGGTGTGTC

TGTGTGTGTGTGTAAGCATGTA

CGGTTGAACAAACTAGGATCAC

(Redd et

al er, among

41 are 33

w beta-haplogroup) and eight with 7

ATAGGTGTGTG

TGTGTGTG

TGTTGAACA

rangutan shows (TAA)4 on the 18th chromosome and (TAA)2

(TGG)1 (TAA)4 on t

DYS425 = 12

GTGGGCTGAGAAATTTCTGGAGACACTTCT

CTTTCTGTCTATAGAAGGCAAGCTAGCT

CTCTCTTCA

GGATTGGAG

CTAGAATTTAGAAAAATGTTGTTGTTGTTG

TTGTTGTTGTTGTTGTTGTTGTTTAATTTC

CATTTTACCTCCAGAATTACT

[Twelve repeats (TGT) in 36 haplogroup base haploty

41, except G2a, G2c, H, H1, L (Klyosov & Rozhanskii,

12)].

himpanzee (Y-Chromosome)

GTGGGCTGAGAAATTTCTGGAAACATTTCT

CTTTCTGTC

CTCTCTTCACTATTGGAGGAG

GGATTGGAGAGAAGAAGAGA

CTAGAATTTAGAAAAATGTTGTTGTTGTTG

TTGTTGTTGTTGTTGTTGTTGTTTAATTTC

CATTTTACCTCCAGAATTACT

[Ten repeats (TGT)]

YS594 = 10

GATGTGCCTAATG

AAAATGGTAAATATTATATTATATTGTATA

CCACAGAATGTATACTT

TATAACAAT

AGAAATAA

TAAAATAAAATAAAATAAAATAA AAAA AAC

AGAAAATACTCGACTATTGGTAAGAACGTT

GCAGCCCCAATGGAAAAGAGCCAGAAAGTT

ACTCAAAGAAATAAAGAAATAGGAAGTTGG

ACTGAGGACACGATTAACACCAGGG

[Ten repeats (TAAAA) in the greatest number

groups: among 41 base haplotypes in haplogroups

ide there are 22 with the allele 10 (including the b

group), 14 with 11, four with 12 and one wit

ozhanskii, 2012)].

Chimpanzee (Y-Chromosome)

GATGTGCCTAATGCCACAGAATGTATACTT

AAAATGGTAAATATTATATTATATTGTATA

TATAACAATAATAAATCTAAA

AGAAATAAAATAAAATAA AA

AGAAAATACTCGACTATTGGTAAGAACGTT

GCAGCCCCAATGGAAAAGAGCCAG AAAGTT

ACTCAAAGGAATAAAGAAATAGGAAGTTGG

ACTGAGGACACGATTAGCACCAGGG

[4 repeats (TAAAA)]

YS436 = 12

CCAGGAGAGCACA

GGTTGTTGTTGTTGTTGT

CACAAAAAGGAA

TGTTGTTTT

TCCCTTTTA

TGAAGTTGGATTGC

[Twelve repeats (GTT) in the greatest number o

groups: among 41 base haplotypes in haplogroup

ide there are 36 with the allele 12 (including th

group) and five with 11 (K

Chimpanzee (Y-Chromosome)

CCACGAGAGCACACACAAAAAGGAAAGCAG

GGTTGTTGTTGTTATGTTTATCACCTCTAA

CGCAGCTCATCCCTTTTACTG

TCCATTGGCTGAAGTTGGATT

[4 repeats (GTT)]

YS490 = 12

AGTATGTCCTTG

ATTATTATTATTATTATT

ACAACATTCTTTATTATT

TGAGACGG

TGGAGTGCA

GCAAGCTCTG

[Twelve repeats (TTA) in the greatest number

groups: among 41 base haplotypes in haplogroup

ide there are 33 with the allele 12 (including the

group), four with 1

Rozhanskii, 2012)].

Chimpanzee (19th Chromosome)

AGTATGTCCTTACCTTATTATTATTATTAT

TATTATTGAGACAG

CCAGGCTGGAGTTCAGTGGCATG

CTCACTGCAGCCTCTG

[Seven repeats (TTA)]

YS450 = 8

AGAGACCAGCTTGG

TTTTGAGAGAACGTGAA

CTGTTGTG

TACATAAC

TCACACAATGGAATATGATGCAGCTGTTTG

TAGATCTGGTAGAAATTATTCTGAATCTAT

CGGTTCCTGGGCCGTTTTTTATTTTATTTT

ATTTTATTTTATTTTATTTTATTTTATTTT

ATTTCATTTTATATTTTATTTTATTTTATT

TTTATTTTATTTTTGGCTGGTGGGTTATTT

ATTACTGATTCCATT

[Fourteen repeats (TTTTA) are shown according to

., 2002) as (TTTTA)9(TTTTA)3 (TTTTA)2; howev

base haplotypes in haplogroups world-wide there

ith the allele 8 (including

lyosov & Rozhanskii, 2012)].

Chimpanzee (Y-Chromosome)

AGAGGCCAGCTTGGCATTTCCACTGCAGCT

TTTTGAGAGAACATGAAAC

TGTTTGTATGTGTGTTTGTGTG

TGTAAGCATACACACAGAACC

AACTAGGATCACCCACACAATGGAATATGA

TGTAGCTTTTTGTAGATCTGGTAGAATTTT

CCAAATCTATCAGTTTCTGGGCTTTTTTTT

…

210

A. A. KLYOSOV ET AL.

NOTE: The chimpanzee Y-Chromosome has no DYS454 ho-

D17 = 12

TCTTTTTATTATTAT

TATTATTATTATTATTATACT

AGGGTACATGTGCACAATGTG

of hap-

lo s world-

wta-hap-

loith 11 and only one with 14

TTCTTCTTCT

TCAAGTTTT

CAGGTTAGT

]

TGCAGTGAGCTGAGATTGGGTG

CAGCCTGGGCAACAAAAGCAA

lo ps world-

w beta-hap-

logroup), 10 with 12, three with 10 and one with 9 (Klyosov &

TGAGGCAGGAGAGTCACTTGAAACTGGAAG

GATTGTATC

GAGCAA

ology]

GATACCACCTTAAGTATATAC

TTCTGTACTTCTACCTGCTTC

lo ps world-

w beta-hap-

lo)].

AATATATAC

CATGCTTC

TCTTTCCATGTTGCTCAGGCTA

TCCTGAGCTGACATGATCCTT

, C, D, E,

ATTGATAGAG

CTAGTCTCA

CTTCCTCCT

ht roup_A/default.as

sogg.org/tree/.

ologous fragments.

YS6

AGCATGATGCCTTCAGCTTTGTTCTTTCTG

CTTAGTACTGTGTTT

TATTATTAT

TTAAGTTTT

CAGGTTAGTTAGTTACATACGTATATATGT

GCCATGCTGGTGTGCTGCACCCATTAACTT

GTCATTTAGCATAAGGTATGTCTCCTAATG

CTATCACTCCCCAATCC

[Twelve repeats (TTA) in the greatest number

groups: among 41 base haplotypes in haplogroup

ide there are 25 with the allele 12 (including the be

group), 12 with 13, three w

lyosov & Rozhanskii, 2012)].

Chimpanzee (Y-Chromosome)

AGCATGATGCCTTCAGGTTTGTTCTTTATG

CTTAGTATTGTGTTTTCTTC

TCTTCTTATTATTATTATACT

AGGGTACATGTGCACAATGTG

TAGTTACATATGTATATATGTGCCATGCTG

GTGTGCTGCACCCATTAACTTGTCATTTAG

CATAAGGTATGTCTCCTAATGCTATCACTC

CCCAATCC

[Repeats (TTA)4 if we follow the human homology

YS568 = 11

GTGGCAGACAAAACCCAGTTACTCGGCAGG

CTGAGGCAGGAGTGTCACTTGAAACCAGAA

GGTGGAGG

ACAACACTC

AACTCCTTCTCAAAAATAAATAAATAAATA

AATAAATAAATAAATAAATAAATA AATAAA

TAAGTCCTCTTTTCCATCTTCCTCTTCAAT

ACCATTGTTTTCCCACGCTTACTGCAAATT

CGCCTAGATGAGTCCCATCCCTTTTCAA

[Eleven repeats (TAAA) in the greatest number of hap-

groups: among 41 base haplotypes in haplogrou

ide there are 27 with the allele 11 (including the

ozhanskii, 2012)].

Chimpanzee (Y-Chromosome)

GTGGCAGGCATTACCAGCTACTCAGGAGGC

GCGGAGGTTGCAGTGAGCCGA

AGTACACTCCAGCCTGGGCAACAA

AACTCCTTCTCCAAAAATTAAATAAATAAA

TAAATAATAACATAAAGAAAGAAAG AAAGA

AAGAAAGAAAGAGTCCTCTTTTCCATCTTC

CTCTTCCATACCATTGTTCTCCTGCACTTA

CTATAAATTTGCCTAGATGAGTCCCACCCT

TTTCAA

[Four repeats (TAAA)4 if we follow the human hom

YS640 = 11

TGGGAAAAACCATGAGATCCTGTCTCAAAA

AATAAATAAATAAATAAATAAATAAATAAA

TAAATAAATAAATAAATCCATTATTGCCCA

ATAGTTTGA

TAAACTTCC

CAGATGTTCTTTTATATTCCTCTAGTCTTT

TTGTGTGTATGAGTGTTTTCATGCATCTGT

AACATATTATTTTCATTATAGATGGTTAAT

AATGTCTTTAAAATATGAACGGGCTTGACC

CTA

[Eleven repeats (TAAA) in the greatest number of hap-

groups: among 41 base haplotypes in haplogrou

ide there are 28 with the allele 11 (including the

group) and 13 with 12 (Klyosov & Rozhanskii, 2012

himpanzee (Y-Chromosome)

TGGGAAAAACCGTGAGATCCTGTCTCAAAA

AATAAATAAACAAATAAATAAATAAATAAA

TAAATAAACAAACCAACCCATTATTGCCCA

ATAGTTTGAGATACCACCTTA

TAAACTTCCTTCTGTACTTCTA

TAGATGTTCTTTTATATTCCTCTAGTCTTT

TTGTGGGTGTGTGTGTTTTCATGCATCTGT

AACATATTATTTTCATTATAGATGGTTAAT

AATGTCTTTAAAATATGAACGGGCTTGACC

CTA

[Repeats (TAAA)2(CAAA)1(TAAA)6 (CAAA)1]

YS492 = 11

AGATGAGCCAGGCTTCAGACCCATGCAGCT

CCATTTCAAGCCCATATCCTATCATTATTA

TTATTATTATTATTATTATTATTATTATTG

ATAGAGAG

GTCTCAAAC

CCTCCTCAGCCTCCAAAAAACCTGGGGTAA

CAAGTGCGAGCCATTGTGCCTGACCCCTAC

[Eleven repeats (TTA) in the oldest haplogroups: B

(Klyosov & Rozhanskii, 2012)].

himpanzee (Y-Chromosome)

AGATGAGCCAGGCTTCAGACCCATGCAGCT

CCATTTCAAGCCCATATCCTATCATTATTA

TTATTATTATTATTATTATT

AGTCTTTCCATGTTGCTCAGG

AACTCCTGAGCTGACATGATC

CAGCCTCCAAAAAACATGGGGTAACAAGTG

CAAGCCATTGTGCCTGACCCCTACT

[Nine repeats (TTA)]

atabases

The FTDNA Haplogroup A Project:

a.com/public/Haplogtp://www.familytreedn

?section=yresults.

ISOGG-20

http://www. i

European Nucleotide Archive (ENA)

A. A. KLYOSOV ET AL.

http://www.ebi.ac.uk/ena/

The National Center for Biotechnology Information (NCBI)

GenBank (http://www.ncbi.nlm.nih.gov/)

ge expansion from Africa. Science, 332,

346-349. doi:10.1126/science.1199295

Acknowledgemen

The authors are indebted to Dr. Judith Remy Leder and Dr.

Alexander S. Zolotarev for their valuable help with the prepara-

tion of the manuscript.

REFERENCES

Atkinson, Q. D. (2011). Phonemic diversity supports a serial founder

effect model of langua

Behar, D. M., Villems, R.Smith, J., Pereira, L.,

Metspalu, E., Scozzadawn of human matri-

, Soodyall, H., Blue-

ri, R. et al. (2008). The

lineal diversity. The American Journal of Human Genetics, 82,

1130-1140. doi:10.1016/j.ajhg.2008.04.002

enazzi, S., Douka, K., Fornai, C., Bauer, C. C., Kullmer, O., Svoboda,

J. et al. (2011). Early dispersal of moder

n humans in Europe and im-

plications for Neanderthal behaviour. Nature, 479, 525-528.

doi:10.1038/nature10617

ampbell, M. C., & Tishkoff, S. A. (2010). The evolution of human

genetic and phenotypic variation in Africa

. Current Biology, 20,

R166-R173. doi:10.1016/j.cub.2009.11.050

arrigan, D., & Hammer, M. F. (2006). Reconstructing human origins

in the genomic era. Nature Reviews, 7, 669-680.

doi:10.1038/nrg1941

Cavalli-Sforza, L. L., Piazza, A., Menozzi, & P., Mountain, J. (1988).

Reconstruction of human evolution: Bringing together genetic,

archaeological, and linguistic data. Proceedings of the National

Academy of Sciences, 85, 6002-6006. doi:10.1073/pnas.85.16.6002

hiaroni, J., Underhill, P. A., & Cavalli-Sforza

Y-chromosome divers

C, L. L. (2009).

ity, human expansion, drift, and cultural evolu-

tion. Proceedings of the National Academy of Sciences, 106, 20174-

20179. doi:10.1073/pnas.0910803106

hromosomal Laboratories (2005). Y chromosomal haplogroup and

ancient origins.

http://www.chromosomal-labs.com/ancestry/yhaplogroup.pdf

ruciani, F., Santolamazza, P., Shen, P., Macaulay, V., Moral, P.,

Olckers, A., Modiano, D. et al. (2002). A back migrartion from Asia

to Sub-Saharan Africa is supported by high-resolution analysis of

human Y-chromosome haplotypes. The American Journal of Human

Genetics, 70, 1197-1214. doi:10.1086/340257

ruciani, F., Trombetta, B., Sellitto, D., Mas-Saia, A., Destro-BisCol, G.,

Watson, E. et al. (2010). Human Y-chromosome haplogroup R-V88:

A paternal genetic record of early mid Holocene trans-Saharan con-

nections and the spread of Chadic languages. European Journal of

Human Genetics, 231, 1-8.

ruciani, F., Trombetta, B., Massaia, A., Destro-CBisol, G., Sellitto, D.,

& Scozzari, R. (2011). A revised root for the human Y chromosomal

phylogenetic tree: The origin of patrilineal diversity in Africa. The

American Journal of Human Ge n e t i c s , 88, 1-5.

doi:10.1016/j.ajhg.2011.05.002

urnoe, D., Xueping, J., HerriesC, A. I. R., Kanning, B., Tacon, P. S. C.,

Zhende, B., Fink, D. et al. (2012). Human remains from the Pleisto-

cene-holocene transition of Southwest China suggest a complex

evolutionary history for East Asians. PLOS One, 7, e31918.

doi:10.1371/journal.pone.0031918

monds, C. A., Lillie, A. S., & CaEdvalli-Sforza, L. L. (2004) Mutations

arising in the wave front of an expanding population. Proceedings of

the National Academy of Sciences, 101, 975-979.

doi:10.1073/pnas.0308064100

ernandes, V., Alshamali, F., Alves, M., Costa, M. D., Pereir

Silva, N. M. et al. (2012). The Arab

Fa, J. B.,

G T., Stenzel, U.,

al. (2010). A draft sequence of the

ian cradle: Mitochondrial relicts

of the first steps along the Southern route out of Africa. The Ameri-

can Journal of Human Genetics, 90, 347-355.

reen, R. E., Krause, J., Briggs, A. W., Maricic,

Kircher, M., Patterson, N. et

Neandertal genome. Science, 328, 710-722.

doi:10.1126/science.1188021

rine, F. E., Bailey, R. M., Harvati, K., Nathan, R. P., Morris, A. G.,

Henderson, G. M., Robot, I. et al. (2007). La

te Pleistocene human

skull from Hofmeyr, South Africa, and modern human origins.

Science, 315, 226-229. doi:10.1126/science.1136294

rine, F. E., Gunz, P., Betti-Nash, L., Neubaue

(2010). Reconstruction of the

Gr, S., & Morris, A. G.

late Pleistocene human skull from

Hofmeyr, South Africa. Journal of Huma n Evolution, 59, 1-15.

doi:10.1016/j.jhevol.2010.02.007

usmao, L., Gonzales-Neira, A., Alves, C., Lareu M, Costa S, Amorim

A, & Carracedo A. (2002). Chimpanzee homologou

s of human Y

aran African hominids. South Af-

specific STRs. A comparative study and a proposal for nomenclature.

Forensic Science Internships, 126, 129-136.

abgood, P. J. (1989). An examination of regional features on middle

and early late Pleistocene Sub-Sah

rican Archaeological Bulletin, 44, 17-22. doi:10.2307/3888315

anihara, T., Ishida, H., & Dodo, Y. (2003). Characterization of bio-

logical diversity through analysis of discrete cranial traits. American

Journal of Physical Anthropology, 121, 241-251.

doi:10.1002/ajpa.10233

ellenthal, G., Auton, A., & Falush, D. (2008). Inferring human colo-

nization history using a copying model. PLOS Genetics, 4, e100

0078.

doi:10.1371/jpurnal.pgen.1000078

enn, B. M., Gignoux, C. R., Jobin, M., Granka, J. M., Macpherson, J.

M., Kidd, J. M., Rodríguez-Botigué, L. et al.

gatherer genomic divers

(2011). Hunter-

ity suggests a southern African origin for

modern humans. Proceedings of the National Academy of Sciences,

108, 5154-5162. doi/10.1073/pnas.1017511108

igham, T., Compton, T., Stringer, C.H, Jacobi, R., Shapiro, B., Trinkaus,

E., Chandler, B. et al. (2011). The earliest evidence for anatomically

modern humans in North-Western Europe. Nature, 479, 521-524.

doi:10.1038/nature10484

offecker, J. F. (2011). The early upper Paleolithic of Eastern Europe

reconsidered. Evolut iona ry Anthropology, 20, 24

-39.

doi:10.1002/evan.20284

ublin, J.-J. (2011). African origin. Nature, 476, 395. H

doi:10.1038/476395a

udhes, J. F., Skaletsky, H.,H Pyntikova, T., Graves, T. A., van Daalen,

structure and

, 536-539. doi:10.1038/nature08700

S. K. M., Minx, P. J., Fulton, R. S. et al. (2010). Chimpanzee and

human Y-chromosomes are remarkably divergent in

gene content. Nature, 463

., Graves, T. A.,

, S. et al. (2012). Strict evolutionary con-

Hudhes, J. F., Skaletsky, H., Brown, L. G., Pyntikova, T

Fulton, R. S., Dugan

servation followed rapid gene loss on human and rhesus

Y-Chromosomes. Nature, 483, 82-86. doi:10.1038/nature10843

udjashov, G., Kivisild, T., Underhill, P. A., Endicott, P., Sanchez, J. J.,

Lin, A. A., Shen, P. et al. (2007). Revealing the prehistoric

settle-

ment of Australia by Y-chromosome and mtDNA analysis. Proceed-

ings of the National Academy of Sciences, 104, 8726-8730.

doi:10.1073/pnas.0702928104

bling, M. A., & Tyler-Smith, C. (2003) The human Y-chromosoJome:

An evolutionary marker comes of age. Nature Reviews, 4, 598-612.

doi:10.1038/nrg1124

lyosov, A. A. (2009). DNA genealogy, mutation rates, and some

historical evidences written in Y-chromosome. I. Basic pr

and the method. Journal of Gen

inciples

etic Genealogy, 5, 186-216.

Klyosov, A. A., & Rozhanskii, I. L. (2011). An archaic lineage of hap-

logroup A. Proceedings of the Russian Academy of DNA Genealogy,

4, 1495-1502.

Klyosov, A. A. (2012). Ancient history of the Arbins, bearers of hap-

logroup R1b, from central Asia to Europe, 16,000 to 1500 years be-

fore present. Advances in Anthropology, 2, 87-105.

doi:10.4236/aa.2012.22010

lyosov, A. A., & Rozhanskii, I. L. (2012a). Re-examining the out of

Africa theory an

d the origin of Europeoids (Caucasoids) in light of

DNA genealogy. Advances in Anthropology, 2, 80-86.

doi:10.4236/aa.2012.22009

lyosov, A. A., & Rozhanskii, I. L. (2012b). Haplogr

proto indo-Europeans and th

Koup R1a as the

e legendary Aryans as witnessed by the

212

A. A. KLYOSOV ET AL.

DNA of their current descendants. Advances in Anthropology, 2,

1-13. doi:10.4236/aa.2012.21001

i, H., & Durbin, R. (2011). Inference of human popula

from individual whole-genom

Ltion history

e sequences. Nature, 475, 493-496.

doi:10.1038/nature10231

ajumder, P. P. (2010). The human genetic history of South Asia.

Current Biology, 20, R184-R187.

doi:10.1016/j.cub.2009.11.053

ellars, P., & French, J. C. (2011M). Tenfold population increase in

Western Europe at the Neandertal-to-modern human transition. Sci-

ence, 333, 623-627. doi:10.1126/science.1206930

ellars, P. (2011). The earlieMst modern humans in Europe. Nature, 479,

483-485. doi:10.1038/479483a

oorjani, P., Patterson, N., Hirschhorn, J. N., Keinan, A., Hao, L.M,

Atzmon, G., Burns, E. et al. (2011). The history of African gene flow

into Southern Europeans, Levantines, and Jews. PLOS Genetics, 7,

e1001373. doi:10.1371/journal.pgen.1001373

Nei, M., & Takezaki, N. (1996). The root of the phylogenetic tree of

human populations. Molecular Biology and Evolution, 13, 170-177.

doi:10.1093/oxfordjournals.molbev.a025553

ttoni, C., Primativo, G., Kashani, B. H., Achilli, A., Martinez-Labarga,

C., Biondi, G., Torroni, A., & Rickards, O. (2010). Mitochondrial

haplogroup H1 in North Africa: An early h

olocene arrival from

Iberia. Plos One, 5, e13378. doi:10.1371/journal.pone.0013378

atin, E., Laval, G., Barreiro, L. B., Salas, A., Semino, O.,

Santachiara-Benerecetti, S., Kidd, K. K. et a

l. (2009). Inferring the

y of

demographic history of African farmers and Pygmy hunter-gatherers

using a multilocus recequencing data set. PLOS Genetics, 5, 1-13.

erelman, P., Johnson, W. E., Roos, C., Seuanez, H. N., Horvath, J. E.,

Moreira, M. A. M., & Kessing, B. (2011). A molecular phylogen

living primates. PLOS Genetics, 7, e1001342.

doi:10.1371/journal.pgen.1001342

inhasi, R., Higham, T. F. G., Golovanova, L. V., & Doronichev, V. B.

(2011). Revised age of late Neanderthal occupation and the end o

Puaud, S. J., Valladas,

(2011). The oldest anatomically

the middle Paleolithic in the northern Caucasus. Proceedings of the

National Academy of Sciences, 108, 8611-8616.

rat, S., Pean, S. C., Crepin, L., Drucker, D. G., P

H., Lasnickova-Galetova, M. et al.

modern humans from far South-East Europe: Direct dating, culture

and behavior. PLOS One, 6, e20843.

doi:10.1371/journal.pone.0020834

rüfer, K., Munch, K., Hellmann, I., Akagi, K., MPiller, J. R., Walenz,

. Forensic value of 14 novel

e. Forensic Science Internships,

B., Koren, S. et al. (2012). The bonobo genome compared with the

chimpanzee and human genomes. Nature, 486, 527-531.

edd, A. J., Agellon, A. B., Kearney, V. A., Contreras, V. A., Karafet,

T., Park, H., de Knijff, P. et al. (2002)

STRs on the human Y-chromosom

130, 97-111. doi:10.1016/S0379-0738(02)00347-X

ightmire, G. P. (2009) Middle and later Pleistocene hominins in Af-

rica and Southwest Asia. Proceedings of the National

RAcademy of

Sciences, 106, 16046-16050. doi:10.1073/pnas.0903930106

ogers, A. R., & Jorde, L. B. (1995). Genetic evidence of modern

human origins. Human B i ol ogy, 67, 1-36.

ozhanskii, I. L., & Klyosov, A. A. (2011). Mutation

R rate constants in

DNA genealogy (Y-Chromosome). Advances in Anthropology, 1,

26-34. doi:10.4236/aa.2011.12005

ahoo, S., Singh, A., Himabindu, G., Banerjee, J., Sitalaximi, T.,

Gaikwad, S., Trivedi, R. et al.

(2006). A prehistory of Indian

Y-chromosomes: Evaluating demic diffusion scenarios. Proceedings

of the National Academy of S ciences, 103, 843-848.

doi:10.1073/pnas.0507714103

cally, A., Dutheil, J. Y., Hillier, L. W., Jordan, G. E.

Herrero, J., Hobolth, A., et

S, Goodhead, I.,

al. (2012). Insights into hominid

evolution from the gorilla genome sequence. Nature, 483, 169-175.

doi:10.1038/nature10842

hi, W., Ayub, Q., Vermeulen, M., Shao, R.-G., Zuniga, S., van der

Gaag, K., de Knijff, P. et

al. (2010). A worldwide survey of human

male demographic history based on Y-SNP and Y-STR data from the

HGDP-CEPH populations. Molecular Biology and Evolution, 27,

385-393. doi:10.1093/molbev/msp243

mms, T. M., Martinez, E., Herrera, K. J., Wright, M. R., Perez, O. A.,

Hernandez, M., Ramirez, E. C., McC

artney, Q., & Herrera, R. J.

(2011). Paternal lineages signal distinct genetic contributions from

British loyalists and continental Africans among different Bahamian

islands. American Journal of Physical Anthropology, 146, 4594-608.

doi:10.1002/ajpa.21616

ares, P., Ermini, L., Thompson, N., Normina, M., Rito, T., Rohl, A.,

Salas, A., Oppenheimer,

S., Macaulay, V., & Richards, M. B. (2009).

Correcting for purifying selection: An improved human mitochon-

drial molecular clock. Journal of Human Genetics, 84, 740-759.

doi:10.1016/j.ajhg.2009.05.001

tewart, J. R., & Stringer, C. B. (2012). Human evolution out of Afri

The role of refugia and climate c

Sca:

hange. Science, 335, 1317-1321.

doi:10.1126/science.1215627

toneking, M, & Delfin, F. (2010). The human genetic history of E

Asia: Weaving a complex tape

Sast

stry. Current Biology, 20, R188-R193.

doi:10.1016/j.cub.2009.11.052

tringer, C. B., & Andrews, P. (1988). Genetic and fossil evidence for

the origin of modern humans. Sc

Sience, 239, 1263-1268.

doi:10.1126/science.3125610

un, J. X., Helgason, A., Masson, G., Ebenesersdóttir, S.

Mallick, S., Patterson, N. et a

S S., Li, H.,

l. (2011). A direct characterization of

human mutation. 61th Annual Meeting, American Society of Human

Genetics/ICHG, 11-15 October 2011, Montreal.

attersall, I. (2009). Human origins: Out of Africa. Proceedings of the

National Academy of Sciences, 106, 16018-16031.

doi:10.1073/pnas.0903207106

nderhill, P. A., Shen, P., Lin, A. A., Jin, L., Passarin

H., Kauffman, E. et al. (2000)

Uo, G., Yang, W.

. Y-chromosome sequence variation

and the history of human populations. N ature Genetics, 26, 358-361.

doi:10.1038/81685

ue, Y., Zerjal, T., Bao, W., Zhu, S., Lim,S.-K., Shu, Q. et al. (2005).

Recent spread of a

Y-chromosomal lineage in Northern China and

Mongolia. The American Journal of Human Genetics, 77, 1112-1116.

doi:10.1086/498583

otova, V., Lefebvre, J.-F., Moreau, C., Gbeha, E., Hovhannesyan, K.,

Bourgeois, S., & Be

darida, S. (2011). An X-linked haplotype of

Neandertal origin is present among all non-African populations.

Molecular Biology and Evolution, 28, 1957-1962

上一篇:Mapping Three-Dimensional Dens 下一篇:Were There Commercial Communic

我要分享到：

职称论文发表交流平台！

Re-Examining the Out-of-Africa Theory and the Origin of Europeoids (Caucasoids). Part 2. SNPs, Haplo

最新文章NEWS

推荐期刊Tui Jian

热点文章HOT